View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_low_37 (Length: 290)
Name: NF0678_low_37
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0678_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 79 - 282
Target Start/End: Complemental strand, 31853241 - 31853038
Alignment:
| Q |
79 |
gaggatgaaaatccttatgtttttgaagacagagattttgaaaccaaaatagaaacagatgatggtagagttatggctctaaacatgtttgatcaaaaat |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31853241 |
gaggatgaaaatccttatgtttttgaagacagagattttgaaaccaaaatagatacagatgatggtagagttatggctctaaacatgtttgatcaaaaat |
31853142 |
T |
 |
| Q |
179 |
caaagctgctcagaaactttgagaattatggtttgaccattttagaagctaaaggacatgcttttgtttcaccacaccactttgattctgaggttatatt |
278 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31853141 |
caaagctgcttagaaactttgagaattatggtttgaccattttagaagctaaaggacatgcttttgtttcaccacaccactttgattctgaggttatttt |
31853042 |
T |
 |
| Q |
279 |
cttc |
282 |
Q |
| |
|
|||| |
|
|
| T |
31853041 |
cttc |
31853038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University