View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_low_40 (Length: 280)
Name: NF0678_low_40
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0678_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 43 - 267
Target Start/End: Complemental strand, 1632560 - 1632335
Alignment:
Q |
43 |
ggaccttgtgctcttccacttgaaaatccggagtggacacatcaattggccgttcctcctcctgtccggttgtggcaccagattgtgatagtaattgaat |
142 |
Q |
|
|
||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
T |
1632560 |
ggaccgtgtgctcttccatttgaaactccggagtggacacatcaattggccgttcctcctcctatccggttggggcaccagattgtgatagtaattgaat |
1632461 |
T |
 |
Q |
143 |
agcatcaggttgcggtattgtattgtcagctgcaacgtcattgatcaccggagcttcgaaagatttagatgaacctatgccgtcttgattatctttgggc |
242 |
Q |
|
|
| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||||||||| |
|
|
T |
1632460 |
aacatcaggccgcggtattgtattgtcagctgcaacgtcattgatcaccggagcttcaaaagctttagatgaacctatgccgtctggattatctttgggc |
1632361 |
T |
 |
Q |
243 |
-tgccatttccgagtctgctgtttct |
267 |
Q |
|
|
||||||||| || |||||||||||| |
|
|
T |
1632360 |
ttgccatttctgattctgctgtttct |
1632335 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University