View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_low_44 (Length: 273)
Name: NF0678_low_44
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0678_low_44 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 2e-89; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 61 - 256
Target Start/End: Original strand, 34864082 - 34864279
Alignment:
Q |
61 |
aagaaaaaagaagatccactgcaccattgaacatggttaattgcacttcaagcgtaactaattgagtcacttttttggttattctattgctatatgatta |
160 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
34864082 |
aagaaaaaagaagatccactgcaccattgaacatggttaattgcactttaagcgtaactaattgagtcacttttttggttatgctattgctatatgatta |
34864181 |
T |
 |
Q |
161 |
tgctaaaacaaacaaataatagactcat--aatcaaaaacatcatattccactaatcagtcaatgtgcacaacagaagtaccggaaatcaccaagcca |
256 |
Q |
|
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
T |
34864182 |
tgctaaaacaaacaaataatagagtcataaaatcaaaaacatcatattccactaatcagtcaatgtgcacaacagaagtactggaaattaccaagcca |
34864279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 27 - 68
Target Start/End: Original strand, 34861041 - 34861082
Alignment:
Q |
27 |
tcaagatcaatgccacacttacttgatcatcataaagaaaaa |
68 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34861041 |
tcaagatcaatgccacacttacttgatcatcataaagaaaaa |
34861082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 230
Target Start/End: Original strand, 7945218 - 7945246
Alignment:
Q |
202 |
atattccactaatcagtcaatgtgcacaa |
230 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
7945218 |
atattccactaatcagtcaatgtgcacaa |
7945246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University