View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_low_47 (Length: 266)
Name: NF0678_low_47
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0678_low_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 38 - 255
Target Start/End: Original strand, 41105173 - 41105388
Alignment:
| Q |
38 |
tttcgtgggggtggtactctagattaaactttgcaagataagtttgaggacttgagggggaggaggcagtgtcctgctttcttttccagtggccactttg |
137 |
Q |
| |
|
||||||||||| ||| ||||||||| ||||||| | ||||||||||||||||||||||| || |||| |||| ||||||||||||| |||||||||| |
|
|
| T |
41105173 |
tttcgtgggggcggtgctctagattcaactttggaggataagtttgaggacttgagggg-agcgggcactgtcttgctttcttttccctcggccactttg |
41105271 |
T |
|
| Q |
138 |
tcataaagctttgcagcccttggatctgttagcagcttcttctgaaaggactgcgaaaaaccagcagcgatgatagtcaacaataatctccacggtgtaa |
237 |
Q |
| |
|
||| ||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |||| || ||||||||| || ||||||| |||||||| |
|
|
| T |
41105272 |
tcaagaagctttgctgcccttggatctgttagcagcttcttctgaaaagactgcgaaaagccagtggcaatgatagtc-acgtgaatctccccggtgtaa |
41105370 |
T |
|
| Q |
238 |
cgatcatcagcaacagct |
255 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
41105371 |
cgatcatcaacaacagct |
41105388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 39 - 81
Target Start/End: Original strand, 41082370 - 41082412
Alignment:
| Q |
39 |
ttcgtgggggtggtactctagattaaactttgcaagataagtt |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41082370 |
ttcgtgggggtggtactctagattaaactttgcaaggtaagtt |
41082412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 143 - 190
Target Start/End: Original strand, 21865268 - 21865315
Alignment:
| Q |
143 |
aagctttgcagcccttggatctgttagcagcttcttctgaaaggactg |
190 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||| || |||||||| |
|
|
| T |
21865268 |
aagctttgcagcccttggatctgttagtagcatcttttggaaggactg |
21865315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1411 times since January 2019
Visitors: 4416