View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_low_48 (Length: 265)
Name: NF0678_low_48
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0678_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 102 - 240
Target Start/End: Original strand, 25864715 - 25864852
Alignment:
| Q |
102 |
aatagatagatttttatttttagggttaaannnnnnnnngcaaatacccctgaaatggtgattttatttcatttaattaaaaaatcacattcctttaaaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25864715 |
aatagatagatttttatttttagggttaaaaaagtttttgcaaatacccctgaa-tggtgattttatttcatttaattaaaaaatcacattcctttaaaa |
25864813 |
T |
|
| Q |
202 |
aattgggcaagtaagttttggagtaaatatgcaaatatt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25864814 |
aattgggcaagtaagttttggagtaaatatgcaaatatt |
25864852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 44 - 77
Target Start/End: Original strand, 25869512 - 25869545
Alignment:
| Q |
44 |
gaatctgcataggatttcagcgatgagatccaat |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
25869512 |
gaatctgcataggatttcagcgatgagatccaat |
25869545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 674 times since January 2019
Visitors: 4390