View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_low_5 (Length: 496)
Name: NF0678_low_5
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0678_low_5 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 218 - 496
Target Start/End: Original strand, 1632162 - 1632441
Alignment:
| Q |
218 |
tgaggtaatgattgagatgtaaggtttttctttttcaatcgaaattatttatgaaagattgccggcattttgcacccactgtagaaacattggacatcac |
317 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1632162 |
tgaggtaatgattgagagggaaggtttttctttttcaatcgaaattatttatgaaagattgccggcattttgcacccactgtagaaacattggacatcac |
1632261 |
T |
|
| Q |
318 |
attacctattgtcggtggctgcaccccaccaatgttactcacatgactgacaaacagaagaaaattgtcccacagaaacagcagactcggaaatggc-ag |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| || |||||||| || |
|
|
| T |
1632262 |
attacctattgtcggtggctgcaccccaccaatgttactcacgtgactgacaaacagaaaaaaattgtcccacagaaacagcagaatcagaaatggcaag |
1632361 |
T |
|
| Q |
417 |
cccaaagataatcaagacggcataggttcatctaaatctttcgaagctccggcgatcaatgacgttgcagctgacaatac |
496 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1632362 |
cccaaagataatccagacggcataggttcatctaaagcttttgaagctccggtgatcaatgacgttgcagctgacaatac |
1632441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 243 - 316
Target Start/End: Complemental strand, 26593502 - 26593429
Alignment:
| Q |
243 |
ttttctttttcaatcgaaattatttatgaaagattgccggcattttgcacccactgtagaaacattggacatca |
316 |
Q |
| |
|
|||||||||||||| || |||| |||||| | |||||||| |||||||| |||||| | |||||||||||||| |
|
|
| T |
26593502 |
ttttctttttcaattgagattacctatgaacgtttgccggcgttttgcacacactgtgggaacattggacatca |
26593429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 277 - 343
Target Start/End: Original strand, 17150364 - 17150430
Alignment:
| Q |
277 |
tgccggcattttgcacccactgtagaaacattggacatcacattacctattgtcggtggctgcaccc |
343 |
Q |
| |
|
||||| |||||||||| ||||||| |||||||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
17150364 |
tgccgtcattttgcactcactgtaagaacattggacatcatattacaagttgtcgatggctgcaccc |
17150430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1023 times since January 2019
Visitors: 4362