View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0678_low_5 (Length: 496)

Name: NF0678_low_5
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0678_low_5
NF0678_low_5
[»] chr7 (1 HSPs)
chr7 (218-496)||(1632162-1632441)
[»] chr6 (1 HSPs)
chr6 (243-316)||(26593429-26593502)
[»] chr2 (1 HSPs)
chr2 (277-343)||(17150364-17150430)


Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 218 - 496
Target Start/End: Original strand, 1632162 - 1632441
Alignment:
218 tgaggtaatgattgagatgtaaggtttttctttttcaatcgaaattatttatgaaagattgccggcattttgcacccactgtagaaacattggacatcac 317  Q
    ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1632162 tgaggtaatgattgagagggaaggtttttctttttcaatcgaaattatttatgaaagattgccggcattttgcacccactgtagaaacattggacatcac 1632261  T
318 attacctattgtcggtggctgcaccccaccaatgttactcacatgactgacaaacagaagaaaattgtcccacagaaacagcagactcggaaatggc-ag 416  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| || |||||||| ||    
1632262 attacctattgtcggtggctgcaccccaccaatgttactcacgtgactgacaaacagaaaaaaattgtcccacagaaacagcagaatcagaaatggcaag 1632361  T
417 cccaaagataatcaagacggcataggttcatctaaatctttcgaagctccggcgatcaatgacgttgcagctgacaatac 496  Q
    ||||||||||||| |||||||||||||||||||||| |||| |||||||||| |||||||||||||||||||||||||||    
1632362 cccaaagataatccagacggcataggttcatctaaagcttttgaagctccggtgatcaatgacgttgcagctgacaatac 1632441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 243 - 316
Target Start/End: Complemental strand, 26593502 - 26593429
Alignment:
243 ttttctttttcaatcgaaattatttatgaaagattgccggcattttgcacccactgtagaaacattggacatca 316  Q
    |||||||||||||| || ||||  |||||| | |||||||| |||||||| |||||| | ||||||||||||||    
26593502 ttttctttttcaattgagattacctatgaacgtttgccggcgttttgcacacactgtgggaacattggacatca 26593429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 277 - 343
Target Start/End: Original strand, 17150364 - 17150430
Alignment:
277 tgccggcattttgcacccactgtagaaacattggacatcacattacctattgtcggtggctgcaccc 343  Q
    ||||| |||||||||| |||||||  |||||||||||||| |||||   |||||| |||||||||||    
17150364 tgccgtcattttgcactcactgtaagaacattggacatcatattacaagttgtcgatggctgcaccc 17150430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University