View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_low_50 (Length: 262)
Name: NF0678_low_50
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0678_low_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 223
Target Start/End: Complemental strand, 55760179 - 55759973
Alignment:
Q |
17 |
caaagggaaaacataaagattgacttctaataaactcatctcattcagatgtgcctttctttcctttgccttttgtttctttgttttgtaacccagctga |
116 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
T |
55760179 |
caaagggaaaacagaaagattgacttctaataaactcatctcattcagatgtgcctttctttcctttgccttttgtttctctgttttgtaacccatctga |
55760080 |
T |
 |
Q |
117 |
gtctgagttctctttgctccaatttcatttattgttttttccctcaatatttcttccttcttttcacttaaatcatatcacatatacatcttataactat |
216 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55760079 |
gtctgagttctctttgctccaatttcatttattgttttttccctcaatatttcttccttcttttcacttaaatcatatcacatatacatcttataactat |
55759980 |
T |
 |
Q |
217 |
taatttt |
223 |
Q |
|
|
||||||| |
|
|
T |
55759979 |
taatttt |
55759973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 87 - 212
Target Start/End: Original strand, 38939537 - 38939659
Alignment:
Q |
87 |
ttttgtttctttgttttgtaacccagctgagtctgagttctctttgctccaatttcatttattgttttttccctcaatatttcttccttcttttcactta |
186 |
Q |
|
|
|||||||||| ||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||| ||| ||||||||| ||||||||| |
|
|
T |
38939537 |
ttttgtttctctgttttgtaacccagctgagtttgagttctctttgcaccgatttcatttattgttttttccctcagtatctcttccttc-tttcactta |
38939635 |
T |
 |
Q |
187 |
aatcatatcacatatacatcttataa |
212 |
Q |
|
|
||||| ||||| ||||||||||||| |
|
|
T |
38939636 |
aatcaaatcac--atacatcttataa |
38939659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 520 times since January 2019
Visitors: 4385