View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_low_58 (Length: 236)
Name: NF0678_low_58
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0678_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 4580272 - 4580326
Alignment:
Q |
31 |
aattccatcttgatgtttgatcattatcaggtttaggggatgtgttatattgaag |
85 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
4580272 |
aattccatcttgatgtttgatcattataaggtttaggggatgtgttatattgaag |
4580326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 4580345 - 4580391
Alignment:
Q |
108 |
aaggaatgttatattgaagtttttgatactgtatttgatattattgg |
154 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
4580345 |
aaggaatgttatattgaagtttttgatactgtatttgatatttttgg |
4580391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University