View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_low_62 (Length: 228)
Name: NF0678_low_62
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0678_low_62 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 14736326 - 14736469
Alignment:
Q |
1 |
ttctccatctccgaggggtatgagccaccacataaatcataaccaaggaaatgtgttatggaaattattcagcttgaggaattgaagattttctgatttt |
100 |
Q |
|
|
||||| |||||||||| ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14736326 |
ttctctatctccgaggtgtatgagccaccacacaaatcataaccaagaaaatgtgttatggaaattattcagcttgaggaattgaagattttctgatttt |
14736425 |
T |
 |
Q |
101 |
ggaaaagcacccatttatctatcaacccaagttagatatttttg |
144 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
14736426 |
ggaaaagcactcatttatctatcaacccaagttagatatttttg |
14736469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University