View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0679-INSERTION-1 (Length: 639)
Name: NF0679-INSERTION-1
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0679-INSERTION-1 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] scaffold0198 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 379 - 639
Target Start/End: Original strand, 1411700 - 1411960
Alignment:
| Q |
379 |
tatttgagctccttttccacttttgaatcaaacacaataacaagattatatccttcttcatttttgaagctaaatattactacattggtacataaattag |
478 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1411700 |
tatttgagctccttttccacttttgaatcaaacacaataacaagattatatccctcttcatttttgaagctaaatattactacattggtacataaattag |
1411799 |
T |
|
| Q |
479 |
actataattaactacaacaagtcttaacatttgggcaaatccctagggggtggaagcatttgtgtctgaggattaggaccatctttcaccagaaacacca |
578 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1411800 |
actataattaactacaacaagtcttaacatttgggtaaatccctagggggtggaagcatttgtgtctgaggattaggaccatctttcaccagaaacacca |
1411899 |
T |
|
| Q |
579 |
tactcattccccaagtagcatgtcgttctatgtggcaatgcarcaaccacatacctgatca |
639 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1411900 |
tactcattccccaagtagcatgtcgttctatgtggcaatgcagcaaccacatacctgatca |
1411960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0198 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0198
Description:
Target: scaffold0198; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 168 - 204
Target Start/End: Complemental strand, 3530 - 3494
Alignment:
| Q |
168 |
taaagtttaggctcaaattctcaccaacaatgattta |
204 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
3530 |
taaaatttaggctcaagttctcaccaacaatgattta |
3494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 989 times since January 2019
Visitors: 4362