View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0679-INSERTION-17 (Length: 184)
Name: NF0679-INSERTION-17
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0679-INSERTION-17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 52 - 183
Target Start/End: Original strand, 8679766 - 8679897
Alignment:
| Q |
52 |
aatttgtaaacacgataatttaaatgaagtgtataattggaagaaaaaccttacaacaaaaatatgttttctattacctcaaagcaactgagttacccaa |
151 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||||||| || |||||| || |||||||||| |
|
|
| T |
8679766 |
aatttgtaaacacaataatttaaatgaagtgtatcattggaaaaaaaaccttacaacaaaaatatattttctattagcttaaagcagctaagttacccaa |
8679865 |
T |
|
| Q |
152 |
ctttaatagaggtttctcaatcatgttttact |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8679866 |
ctttaatagaggtttctcaatcatgttttact |
8679897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 4e-18
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 8679893 - 8679947
Alignment:
| Q |
1 |
ttactgaatcgatgtagagaaatgtatgtcagacattattttatttccaccaatt |
55 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
8679893 |
ttactgaatcgatgtagagaaatatatgtcagacattattttttttccaccaatt |
8679947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 55 - 99
Target Start/End: Complemental strand, 7427540 - 7427496
Alignment:
| Q |
55 |
ttgtaaacacgataatttaaatgaagtgtataattggaagaaaaa |
99 |
Q |
| |
|
||||||| | |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
7427540 |
ttgtaaatatgatattttaaatgaagggtataattggaagaaaaa |
7427496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 35 times since January 2019
Visitors: 4368