View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0679-INSERTION-20 (Length: 188)

Name: NF0679-INSERTION-20
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0679-INSERTION-20
NF0679-INSERTION-20
[»] chr3 (1 HSPs)
chr3 (26-165)||(43143217-43143356)


Alignment Details
Target: chr3 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 26 - 165
Target Start/End: Complemental strand, 43143356 - 43143217
Alignment:
26 tattaatatgatctaactattcaaaaacatttgaatgagatggtnnnnnnntatcttgcaacttacctatatgaatccagcactcaaaatacaactttaa 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||    
43143356 tattaatatgatctaactattcaaaaacatttgaatgagatggtaaaaaaatatcttgcaacttacctatatgaatccagcactcaaaatacaactttaa 43143257  T
126 aatacctaattcacaccaaaagaacattcaaacgttgaac 165  Q
    ||||||||||||||||||||||||||||||||||||||||    
43143256 aatacctaattcacaccaaaagaacattcaaacgttgaac 43143217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University