View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0679-INSERTION-20 (Length: 188)
Name: NF0679-INSERTION-20
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0679-INSERTION-20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 26 - 165
Target Start/End: Complemental strand, 43143356 - 43143217
Alignment:
| Q |
26 |
tattaatatgatctaactattcaaaaacatttgaatgagatggtnnnnnnntatcttgcaacttacctatatgaatccagcactcaaaatacaactttaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43143356 |
tattaatatgatctaactattcaaaaacatttgaatgagatggtaaaaaaatatcttgcaacttacctatatgaatccagcactcaaaatacaactttaa |
43143257 |
T |
 |
| Q |
126 |
aatacctaattcacaccaaaagaacattcaaacgttgaac |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43143256 |
aatacctaattcacaccaaaagaacattcaaacgttgaac |
43143217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University