View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0679-INSERTION-23 (Length: 231)
Name: NF0679-INSERTION-23
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0679-INSERTION-23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 67 - 230
Target Start/End: Original strand, 32618780 - 32618943
Alignment:
| Q |
67 |
caattgcgatatttgactgcaattcttcacaatatcaatgatcacaacattgatttaaaaccttcgtttcataacaaggttttaaattacaatcgtgact |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32618780 |
caattgcgatatttgactgcaattcttcacaatatcaatgatcacaacattgatttaaaaccttcgtttcataacaaggttttaaattacaattgtgact |
32618879 |
T |
|
| Q |
167 |
ataggatccattttaaaagaattgatatattgataacgttaacattgatttaagaatattaaag |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32618880 |
ataggatccattttaaaagaattgatatattgataacgttaacattgatttaagaatattaaag |
32618943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 32618939 - 32618974
Alignment:
| Q |
1 |
taaagaacaaatacttatctaagagaatgatatatt |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32618939 |
taaagaacaaatacttatctaagagaatgatatatt |
32618974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1036 times since January 2019
Visitors: 4362