View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0679-INSERTION-5 (Length: 191)
Name: NF0679-INSERTION-5
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0679-INSERTION-5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 9e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 9e-75
Query Start/End: Original strand, 8 - 178
Target Start/End: Complemental strand, 40380981 - 40380811
Alignment:
| Q |
8 |
atatgttcttctttgccagaaatcgcttcatatcaatttcagcatatgctgaaaaggttatttagaaaatccttcttgctagcaatacatcatcattgtt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40380981 |
atatgttcttctttgccagaaatcgcttcatatcaatttcagcatatgctgaaaaagttatttagaaaatccttcttgctagcaatacaccatcattgtt |
40380882 |
T |
 |
| Q |
108 |
cnnnnnnncgtatgaagcgagatcgacattagaatctgccaaatgaacaaagacaacaatgtaggaagtat |
178 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40380881 |
ctttttttcgtatgaagcgagatcgacattagaatctgccaaatgaacaaagacaacaatgtaggaagtat |
40380811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 171
Target Start/End: Complemental strand, 40392322 - 40392197
Alignment:
| Q |
50 |
catatgctgaaaaggttatttagaaaatccttcttgctagcaatacatcatcattgttc-nnnnnnncgtatgaag----cgagatcgacattagaatct |
144 |
Q |
| |
|
||||||||||||| ||||| ||||||||||| ||| ||||||||||| ||||||| || |||||||| |||||||||||||||| ||| |
|
|
| T |
40392322 |
catatgctgaaaaagttatgtagaaaatcctgcttactagcaatacacaatcattgctctttttttttgtatgaagtgatcgagatcgacattagactct |
40392223 |
T |
 |
| Q |
145 |
gccaaatgaacaaagacaacaatgtag |
171 |
Q |
| |
|
||| | ||||||||||||||||||||| |
|
|
| T |
40392222 |
gcc-attgaacaaagacaacaatgtag |
40392197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University