View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0679_high_11 (Length: 360)
Name: NF0679_high_11
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0679_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 4 - 232
Target Start/End: Original strand, 20752818 - 20753046
Alignment:
| Q |
4 |
acctccagatgcaacgttaacaccatgcaagaatgatacattcttcttgttgaaattgattttagatactaaggagaggtaaggtggtgacgtggcaaga |
103 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20752818 |
acctccagatgcaaagttaacaccatgcaagaatgatacattcttcttgttgaaattgattttagatactaaggagaggtaaggtggtgacgtggcaaga |
20752917 |
T |
 |
| Q |
104 |
cctactttttcagctgcaaccaaatataccatggcgagtcaaacaaaatttgttgattttatgcaaatattagcaaaacaaaaattttatattactatta |
203 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20752918 |
cctattttttcagctgcaaccaaatataccatggcaagtcaaacaaaatttgttgattttatgcaaatattagcaaaacaaaatttttatattactatta |
20753017 |
T |
 |
| Q |
204 |
ccaataatcaatatgcatgccccaacata |
232 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20753018 |
ccaataatcaatatgcatgccccaacata |
20753046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 8 - 122
Target Start/End: Original strand, 20758061 - 20758175
Alignment:
| Q |
8 |
ccagatgcaacgttaacaccatgcaagaatgatacattcttcttgttgaaattgattttagatactaaggagaggtaaggtggtgacgtggcaagaccta |
107 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |||||||| ||||| |||| |
|
|
| T |
20758061 |
ccagatgcaaagttaacaccatccaagaatgatacattcttcttgttgaaattgatcttagatactagtgagaggtaaggaggtgacgtagcaaggccta |
20758160 |
T |
 |
| Q |
108 |
ctttttcagctgcaa |
122 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
20758161 |
atttttcagctgcaa |
20758175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University