View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0679_high_19 (Length: 250)

Name: NF0679_high_19
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0679_high_19
NF0679_high_19
[»] chr2 (1 HSPs)
chr2 (1-134)||(37290683-37290816)


Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 37290816 - 37290683
Alignment:
1 gtaaggcactgctattctcaaaggctttccattgtttgggaaaacccatcctcttggtgttgctatagtttctccgggccacagaacattgaacagtttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37290816 gtaaggcactgctattctcaaaggctttccattgtttgggaaaacccatcctcttggtgttgctatagtttctccgggccacagaacattgaacagtttt 37290717  T
101 tggttgcttattgaactgttaggtggtctcttgt 134  Q
    ||||||||||||||||||||||||||||||||||    
37290716 tggttgcttattgaactgttaggtggtctcttgt 37290683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University