View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0679_high_4 (Length: 457)
Name: NF0679_high_4
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0679_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 30 - 442
Target Start/End: Original strand, 55286480 - 55286892
Alignment:
Q |
30 |
gattctgggaaaggtgttagttcgttgaagattttgagttacaatgtttggttccgtgaggatttggagttggagaagaggatgaaagctattggtgatc |
129 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55286480 |
gattctggtaaaggtgttagttcgttgaagattttgagttacaatgtttggttccgtgaggatttggagttggagaagaggatgaaagctattggtgatc |
55286579 |
T |
 |
Q |
130 |
ttgttttgatgcattcccctgattttatctgttttcaggtttctttatcattacatattactatatttaaaatctctctatcatcaatacttctggtaga |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
55286580 |
ttgttttgatgcattcccctgattttatctgttttcaggtttctttatcattacatattactatatttaaaatctctctagcatcaatacttctggtaga |
55286679 |
T |
 |
Q |
230 |
aaacgtgtacgatgtttgacacatgtcaatatccaacaccaacacgacactgaccaacacatgtgatcacattcaattatatcaattttcgaaataatta |
329 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
55286680 |
aagcgtgtacgatgtttgacacatgtcaatatccaacaccaacacgacactgaccaacacatgtgatcacattcaattatgtcaattttcgaaataatta |
55286779 |
T |
 |
Q |
330 |
ctggtttcaacgtgtcagtgttagtatgcgtctgatgtctgtgtctatgtttgtgcttaatagtttaccataaagcnnnnnnngcattttatatttgtgt |
429 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
55286780 |
ctggtttcaaggtgtcagtgttagtatgcgtctgatgtctgtgtctatgtttgtgcttaatagtttaccataaagctttttttgcattttatatttgtgt |
55286879 |
T |
 |
Q |
430 |
ggctttgtttgat |
442 |
Q |
|
|
||||||||||||| |
|
|
T |
55286880 |
ggctttgtttgat |
55286892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University