View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0679_low_14 (Length: 365)
Name: NF0679_low_14
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0679_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 43 - 356
Target Start/End: Original strand, 34555866 - 34556180
Alignment:
Q |
43 |
aagttactcaaagcatgtatggtttacaacatgccaattctgtgattgtcctgatcatgctagtccttggaagtttgtttctcaagtttcaactactttt |
142 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34555866 |
aagttactcaaagcatgtatggtttacaacatgccaattctgtgattgtcctgatcatgctagtccttggaagtttgtttctcaagtttcaactactttt |
34555965 |
T |
 |
Q |
143 |
tagtcctctcttgttgagtgttagtgatagttctcaaattagattctgggagagtattcaggaacttttctc-ttttcatggtttttcctatacttcttt |
241 |
Q |
|
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
T |
34555966 |
tagtcttctcttgttgagtgttagttatagttctcaaattagattctgggagagtattcaggaacttttctctttttcatggcttttcctatacttcttt |
34556065 |
T |
 |
Q |
242 |
tacagtcaactttacaccatttctgtctagttcctttcaaattttgaccttttcaataaccttcataatcatgaaaggttggtgagtttaagtctcttat |
341 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34556066 |
tacagtcaactttacaccatttctgtctagttcctttcaaattttgaccttttcaataaccttcataatcatgaaaggttggtgagtttaagtctcttat |
34556165 |
T |
 |
Q |
342 |
gcttttacttcatct |
356 |
Q |
|
|
||||||||||||||| |
|
|
T |
34556166 |
gcttttacttcatct |
34556180 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University