View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0679_low_17 (Length: 336)
Name: NF0679_low_17
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0679_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 5e-44; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 69 - 250
Target Start/End: Complemental strand, 40405660 - 40405479
Alignment:
| Q |
69 |
cagagactaagcacccttcttgcattttacaatattatatgaaattgaaagtttaggttaagannnnnnnnnnnnnnnnnnnnnnnnncccggtcatgga |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
40405660 |
cagagactaagcacccttcttgcattttacaatattatatgaaattgatagtttaggttaagattttttctttttcaatttttattttcccggtcatgga |
40405561 |
T |
|
| Q |
169 |
tcccatgttaaaatcagactttgctaccagcacctccacctgcacgattggaatcggttccaatcttcacaacatcaattat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
40405560 |
tcccatgttaaaatcagactttgctaccggcacctccacctgcacgattgggatctgttccaatcttcacaacatcaattat |
40405479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 743 times since January 2019
Visitors: 4390