View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0679_low_20 (Length: 319)
Name: NF0679_low_20
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0679_low_20 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 98 - 319
Target Start/End: Complemental strand, 52796237 - 52796016
Alignment:
Q |
98 |
ccaatcactggccaacatcttggtccaggtggaagctgatgaccaagtttcactcttatatgtttcatcaccattgccaaccacatccataccaaaacgg |
197 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
52796237 |
ccaaccactggccaacatcttggtccaggtggaagctgatgaccaagtttcactcttatatgtttcatcaccattgccaaccaaatccataccaaaacgg |
52796138 |
T |
 |
Q |
198 |
ctagtaccaaacccacaaccccgtaatattccatatttacttcgtctgctaatgattatattgatttagttatagggcacctttccttcttatataattg |
297 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52796137 |
ctagtaccaaacccacaaccccgtaatattccatatttacttcgtctgctaatgattatattgatttagttatagggcacctttccttcttatataattg |
52796038 |
T |
 |
Q |
298 |
cttcctggcaccaccaaacaaa |
319 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
52796037 |
cttcctggcaccaccaaacaaa |
52796016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1156 times since January 2019
Visitors: 4407