View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0679_low_22 (Length: 318)
Name: NF0679_low_22
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0679_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 4e-29; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 164 - 237
Target Start/End: Original strand, 31139838 - 31139911
Alignment:
| Q |
164 |
gagaacttttacttcacaaggtaaaaatcttcacaatttctcaagaaatcgagaccattactatattgttggag |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
31139838 |
gagaacttttacttcacaaggtaaaaatcttcacaatttctcaagaaatcgagaccattactatagttttggag |
31139911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 99 - 237
Target Start/End: Complemental strand, 31101231 - 31101092
Alignment:
| Q |
99 |
gtaagaaacaatgtgtaacagtatctgaaatgacaacttgtattactgtnnnnnnnnnnnnnnnn-gagaacttttacttcacaaggtaaaaatcttcac |
197 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31101231 |
gtaagaaacaatgtgtaacagtatctaaaatgacaacttgtattgctgtaaaaaaaaaaaaaaaaagagaacttttacttcacaaggtaaaaatcttcac |
31101132 |
T |
|
| Q |
198 |
aatttctcaagaaatcgagaccattactatattgttggag |
237 |
Q |
| |
|
||||||||||||||||||||||||| ||||| | |||||| |
|
|
| T |
31101131 |
aatttctcaagaaatcgagaccattgctatagttttggag |
31101092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 99 - 147
Target Start/End: Original strand, 31139766 - 31139814
Alignment:
| Q |
99 |
gtaagaaacaatgtgtaacagtatctgaaatgacaacttgtattactgt |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31139766 |
gtaagaaacaatgtgtaacagtatctgaaatgacaacttgtattactgt |
31139814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 977 times since January 2019
Visitors: 4400