View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0679_low_29 (Length: 254)
Name: NF0679_low_29
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0679_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 33 - 137
Target Start/End: Original strand, 7285851 - 7285955
Alignment:
| Q |
33 |
gatgttagacttgttttaatgttgatacaacatgattgtaaacttctggttaaatagttgcatattaatcggtatgtccatgattattaattagtattgt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7285851 |
gatgttagacttgttttaatgttgatacaacatgattgtaaacttctggttaaatagttgcatattaatcggtatgtccatgattattaattagtattgt |
7285950 |
T |
|
| Q |
133 |
tcatg |
137 |
Q |
| |
|
||||| |
|
|
| T |
7285951 |
tcatg |
7285955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 209 - 239
Target Start/End: Original strand, 7286027 - 7286057
Alignment:
| Q |
209 |
agtatggagaagtagttgttactaatatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7286027 |
agtatggagaagtagttgttactaatatatt |
7286057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 636 times since January 2019
Visitors: 4387