View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0679_low_31 (Length: 251)
Name: NF0679_low_31
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0679_low_31 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 251
Target Start/End: Original strand, 19173435 - 19173667
Alignment:
| Q |
19 |
ggacatcatcgacatcagctatagtcatgagtttgatgtcattgttgaatagcctttctaaattgtatggtccaactatggaaagtgatccattccataa |
118 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19173435 |
ggacatcaactacatcagctatagtcatgagtttgatgtcattgttgaatagcctttctaaattgtatggtccaactatggaaagtgatccattccataa |
19173534 |
T |
|
| Q |
119 |
agcctttgcaaattgctcatgaatcttctctgttgggtggaatgaatcccaccaaacaaactcttcaacattgtcacataagttgtattctttaattgtt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19173535 |
agcctttgcaaattgctcatgaatcttctctgttgggtggaatgaatcccaccaaacaaactcatcaacattgtcacataagttgtattctttaattgtc |
19173634 |
T |
|
| Q |
219 |
tttgtgcccccacatgtgtagatacctccatat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
19173635 |
tttgtgcccccacatgtgtagatacctccatat |
19173667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 19178480 - 19178534
Alignment:
| Q |
31 |
catcagctatagtcatgagtttgatgtcattgttgaatagcctttctaaattgta |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19178480 |
catcagctatagtcatgagtttgatgtcattgttgaatagcctttctaaattgta |
19178534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 688 times since January 2019
Visitors: 4390