View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0679_low_40 (Length: 201)
Name: NF0679_low_40
Description: NF0679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0679_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 36287148 - 36287047
Alignment:
Q |
30 |
ctaagttgaaaacaaatgagactttaaaagagtctatcaagggttattagagaatgacacctcacaatcttccattcaaccagatgaagcctatgatact |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
T |
36287148 |
ctaagttgaaaacaaatgagactttaaaagagtctatcaagggttattagagaatgacacctcacaatcttccattcaaccagatgaagcttatgatcct |
36287049 |
T |
 |
Q |
130 |
ac |
131 |
Q |
|
|
|| |
|
|
T |
36287048 |
ac |
36287047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University