View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0680_low_16 (Length: 290)

Name: NF0680_low_16
Description: NF0680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0680_low_16
NF0680_low_16
[»] chr2 (1 HSPs)
chr2 (220-253)||(43425910-43425943)


Alignment Details
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 220 - 253
Target Start/End: Complemental strand, 43425943 - 43425910
Alignment:
220 caacttgcagtgggaagaaatgtttggaagacta 253  Q
    ||||||||||||||||||||||||||||||||||    
43425943 caacttgcagtgggaagaaatgtttggaagacta 43425910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University