View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0680_low_16 (Length: 290)
Name: NF0680_low_16
Description: NF0680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0680_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 220 - 253
Target Start/End: Complemental strand, 43425943 - 43425910
Alignment:
Q |
220 |
caacttgcagtgggaagaaatgtttggaagacta |
253 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
43425943 |
caacttgcagtgggaagaaatgtttggaagacta |
43425910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1259 times since January 2019
Visitors: 4413