View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0680_low_18 (Length: 267)
Name: NF0680_low_18
Description: NF0680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0680_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 26 - 243
Target Start/End: Original strand, 8061782 - 8061999
Alignment:
| Q |
26 |
caacaatattggcatcaattacaaacaaaatgttgaaagttctaaaccaaaccctaactcaagaactagggttttacaccacagtattaacattaggcaa |
125 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8061782 |
caacaatattggcatcaatttcaaacaaaatgttgaaagttctaaaccaaaccctaactcaagaactagggttttacaccacagtattaacattaggcaa |
8061881 |
T |
|
| Q |
126 |
catcaattactcaagtgtgccatttaaatgcaagatcacaatatagacaccttaaccaaataattatattggatcaaacaaaaacaaaaagtctactagt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8061882 |
catcaattactcaagtgtgccatttaaatgcaagatcacaatatagacaccttaaccaaataattatattggatcaaacaaaaacaaaaagtctattagt |
8061981 |
T |
|
| Q |
226 |
cccttccacatattattc |
243 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
8061982 |
cccttccacatattattc |
8061999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1629 times since January 2019
Visitors: 4425