View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0680_low_25 (Length: 217)
Name: NF0680_low_25
Description: NF0680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0680_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 37 - 199
Target Start/End: Complemental strand, 39931292 - 39931130
Alignment:
| Q |
37 |
atgtaaatttcactgtttttctcactatnnnnnnntggatcatattatatttacacaaaaaattaagcatgtttatatttaattttatactgttgaataa |
136 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39931292 |
atgtaaatttcactgtttttctcactataaaaaaatggatcattttatatttacacaaaaaattaagcatgtttatatttaattttatactgttgaataa |
39931193 |
T |
|
| Q |
137 |
actataggtatgatagcggggatgtcacttggaagcaccggaattgttggaagcttgtttgta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
39931192 |
actataggtatgatagcggggatgtcacttggaagcaccggaattgttggaaacttgattgta |
39931130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 139 - 199
Target Start/End: Original strand, 39691027 - 39691087
Alignment:
| Q |
139 |
tataggtatgatagcggggatgtcacttggaagcaccggaattgttggaagcttgtttgta |
199 |
Q |
| |
|
||||||||||||| ||||| ||||||||| |||||| ||||||||||||| |||| ||||| |
|
|
| T |
39691027 |
tataggtatgataacggggttgtcacttgcaagcactggaattgttggaaacttgattgta |
39691087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 336 times since January 2019
Visitors: 4379