View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0680_low_26 (Length: 215)
Name: NF0680_low_26
Description: NF0680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0680_low_26 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 79 - 215
Target Start/End: Complemental strand, 37494817 - 37494681
Alignment:
| Q |
79 |
taattctagaaggagaattggggtagtggagtttgcatttgattgaatgcaaaaatttatttttcctttgcggtatccaaatattgtgcctgtgatggtg |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37494817 |
taattctagaaggagaattggggtagtggagtttgcatttgattgaatgcaaaaacttatttttcctttgcggtatccaaatattgtgcctgtaatggtg |
37494718 |
T |
|
| Q |
179 |
gtggatggtgtgagtgaagaagaggagtatttggata |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37494717 |
gtggatggtgtgagtgaagaagaggagtatttggata |
37494681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 222 times since January 2019
Visitors: 4374