View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0680_low_8 (Length: 377)
Name: NF0680_low_8
Description: NF0680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0680_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 177 - 328
Target Start/End: Original strand, 33097633 - 33097786
Alignment:
| Q |
177 |
gaaataaaataggtccaaaatcttgttaaggctttttaaataacggcagcacacgaatcctttgtgccctgttaaaaggttgttactttattgtaagt-- |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33097633 |
gaaataaaataggtccaaaatcttgttaaggctttttaaataacggcagcacacgaatcctttgtgccctgttaaaaggttgttactttattgtaagtta |
33097732 |
T |
 |
| Q |
275 |
tattcataagggaatccaataaaattaacttcatggattttcattacctatatt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33097733 |
tattcataagggaatccaataaaattaacttcatggattttcattacctatatt |
33097786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 66 - 169
Target Start/End: Original strand, 33097448 - 33097550
Alignment:
| Q |
66 |
attaatcggttattattatttctatttttattgcgtatcggtacaattatcactaattcattcatgcattatgttctctagcttatataaataggtccaa |
165 |
Q |
| |
|
||||||||||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33097448 |
attaatcggttattattatttttatttttttt-cgtatcggtacaattatcactaattcattcatgcattatgttctctagcttatataaataggtccaa |
33097546 |
T |
 |
| Q |
166 |
aatc |
169 |
Q |
| |
|
|||| |
|
|
| T |
33097547 |
aatc |
33097550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University