View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0680_low_9 (Length: 358)
Name: NF0680_low_9
Description: NF0680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0680_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 194 - 345
Target Start/End: Original strand, 3229958 - 3230109
Alignment:
| Q |
194 |
aatatgtttggttattgaatttttaaataannnnnnngcaatttggaccgccgatattatattaaaggcttgccagccctcaataaaggcttgccgacag |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3229958 |
aatatgtttggttattgaatttttaaataattttttttcaatttggaccgccgatattatattaaaggcttgcgagccctcaataaaggcttgccgacag |
3230057 |
T |
|
| Q |
294 |
gggggtgtctttggtcttagaaggcataaaccgcctttcctatcttctagaa |
345 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3230058 |
gggggcgtctttggtcttagaaggcataaaccgcctttcccatcttctagaa |
3230109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 30 - 137
Target Start/End: Original strand, 3229795 - 3229902
Alignment:
| Q |
30 |
catttctctgccaattttttgagggagaagagtgaagcaaatgaactaatagataaatgggtcattatgaagaacctgccgggtgaggtatgtaatagtg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3229795 |
catttctctgccaattttttgagggagaagagtgaagcaaatgaactaatagataaatgggtcattatgaagaacctgccgggagaggtatgtaatagtg |
3229894 |
T |
|
| Q |
130 |
ttaagaaa |
137 |
Q |
| |
|
|||||||| |
|
|
| T |
3229895 |
ttaagaaa |
3229902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 100
Target Start/End: Complemental strand, 3181640 - 3181570
Alignment:
| Q |
30 |
catttctctgccaattttttgagggagaagagtgaagcaaatgaactaatagataaatgggtcattatgaa |
100 |
Q |
| |
|
|||||||||||||| ||||||| ||| ||||| |||||| |||||||||||||||||||| |||| ||||| |
|
|
| T |
3181640 |
catttctctgccaagtttttgaaggaaaagagagaagcagatgaactaatagataaatggatcataatgaa |
3181570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 291
Target Start/End: Original strand, 47827346 - 47827400
Alignment:
| Q |
237 |
tggaccgccgatattatattaaaggcttgccagccctcaataaaggcttgccgac |
291 |
Q |
| |
|
||||||| |||||||||||||| |||||| | |||||||||||||||||||||| |
|
|
| T |
47827346 |
tggaccgtcgatattatattaagggcttgtcgtccctcaataaaggcttgccgac |
47827400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 291
Target Start/End: Original strand, 47832040 - 47832094
Alignment:
| Q |
237 |
tggaccgccgatattatattaaaggcttgccagccctcaataaaggcttgccgac |
291 |
Q |
| |
|
||||||||| |||||||||||| |||||| | |||||||||||||||||||||| |
|
|
| T |
47832040 |
tggaccgccaatattatattaagggcttgtcgtccctcaataaaggcttgccgac |
47832094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 287
Target Start/End: Original strand, 4330066 - 4330116
Alignment:
| Q |
237 |
tggaccgccgatattatattaaaggcttgccagccctcaataaaggcttgc |
287 |
Q |
| |
|
|||||| || ||| |||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
4330066 |
tggacctccaataatatattaagggcttgccatccctcaataaaggcttgc |
4330116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 282
Target Start/End: Complemental strand, 33123822 - 33123777
Alignment:
| Q |
237 |
tggaccgccgatattatattaaaggcttgccagccctcaataaagg |
282 |
Q |
| |
|
|||||| ||||||||||||||| ||||||| |||| |||||||||| |
|
|
| T |
33123822 |
tggaccaccgatattatattaagggcttgctagccttcaataaagg |
33123777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 571 times since January 2019
Visitors: 4387