View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0681_high_5 (Length: 322)

Name: NF0681_high_5
Description: NF0681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0681_high_5
NF0681_high_5
[»] chr5 (1 HSPs)
chr5 (7-128)||(15979823-15979944)


Alignment Details
Target: chr5 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 7 - 128
Target Start/End: Complemental strand, 15979944 - 15979823
Alignment:
7 tcgaagaatatagccagccacttgtaaattcatgacggaagcatttgcacactctcttttggattcgagagtacgttaagtacaaaattgattggaacac 106  Q
    ||||| ||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |||||||||    
15979944 tcgaacaatgtagccagccacttgtaaattcatgacggaagcatttgcacacactcttttggattcaagagtacgttaagtacaaaattgtttggaacac 15979845  T
107 cattttgtttataaaacactat 128  Q
    ||||||||| |||||| |||||    
15979844 cattttgttcataaaatactat 15979823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 153 times since January 2019
Visitors: 4371