View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0681_low_12 (Length: 322)
Name: NF0681_low_12
Description: NF0681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0681_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 7 - 128
Target Start/End: Complemental strand, 15979944 - 15979823
Alignment:
| Q |
7 |
tcgaagaatatagccagccacttgtaaattcatgacggaagcatttgcacactctcttttggattcgagagtacgttaagtacaaaattgattggaacac |
106 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
15979944 |
tcgaacaatgtagccagccacttgtaaattcatgacggaagcatttgcacacactcttttggattcaagagtacgttaagtacaaaattgtttggaacac |
15979845 |
T |
 |
| Q |
107 |
cattttgtttataaaacactat |
128 |
Q |
| |
|
||||||||| |||||| ||||| |
|
|
| T |
15979844 |
cattttgttcataaaatactat |
15979823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University