View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0681_low_14 (Length: 319)
Name: NF0681_low_14
Description: NF0681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0681_low_14 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 99 - 319
Target Start/End: Original strand, 28128761 - 28128981
Alignment:
| Q |
99 |
aactacatcagaagtactctaacttaatttaaaattttaaacagattctttatttannnnnnncgtttaaagttgatcatttatgttttaaaacgtctaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28128761 |
aactacatcagaagtactctaacttaatttaaaattttaaacagattctttatttatttttttcgtttaaaattgatcatttatgttttaaaacgtctaa |
28128860 |
T |
 |
| Q |
199 |
cactaacccgatggtatcttgacgaggtgaaattggtatgacaccagccctgctagtgagtccaacagttggcttgattcccactactgaattgtgatca |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28128861 |
cactaacccgatggtatcttgacgaggtgaaattggtatgacaccagccctgctactgagtccaacagttggcttgattcccactactgaattgtgatca |
28128960 |
T |
 |
| Q |
299 |
gctggacagatgatggagcca |
319 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
28128961 |
gctggacagataatggagcca |
28128981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 175 - 319
Target Start/End: Original strand, 28110331 - 28110474
Alignment:
| Q |
175 |
tcatttatgttttaaaacgtctaacactaacccgatggtatcttgacgaggtgaaattggtatgacaccagccctgctagtgagtccaacagttggcttg |
274 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| || |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28110331 |
tcatttatgtttaaaaacgtctg-cactaacccaatagtatcttgacgaggtgaaatcggtatgacgccagccctgctagtgagtccaacagttggcttg |
28110429 |
T |
 |
| Q |
275 |
attcccactactgaattgtgatcagctggacagatgatggagcca |
319 |
Q |
| |
|
|| ||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
28110430 |
atccccactactgagttgtgatcagctggacagataatggagcca |
28110474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University