View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0681_low_16 (Length: 308)
Name: NF0681_low_16
Description: NF0681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0681_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 83 - 270
Target Start/End: Original strand, 1430785 - 1430972
Alignment:
Q |
83 |
agcaacgtctagttcctgaccgttttctgccataaccacgcttgccagaacataatgctctaaagcactttcataatcaccttttgagtcacagattagt |
182 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1430785 |
agcaacgtctagttcctgaccgttttctgccataaccacgcttgccagaacataatgctctaaagcactttcataatcaccttttgagtcacagattagt |
1430884 |
T |
 |
Q |
183 |
cccatcaatctccgatcagctgcttcttcaaacgatgcaggcaaaccatttcccttatgaatatcaagagccatttgacacaggttct |
270 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
1430885 |
cccatcaatctccgatcagctgcttcttcaaacgatgcaggcaaaccatttcccttatgaatatcaagagccatttgacacagcttct |
1430972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1081 times since January 2019
Visitors: 4402