View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0681_low_18 (Length: 298)
Name: NF0681_low_18
Description: NF0681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0681_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 54 - 143
Target Start/End: Complemental strand, 50632382 - 50632290
Alignment:
Q |
54 |
aaaacattggtcattcattcattcaacaaaaacaaacacact---cttgaattctagttgaaagagaaaatgaagaaaacatcaacttgtgtg |
143 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50632382 |
aaaacattggtcattcattcattccacaaaaacaaacacactactcttgaattgtagttgaaagagaaaatgaagaaaacatcaacttgtgtg |
50632290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 203 - 259
Target Start/End: Complemental strand, 50632230 - 50632174
Alignment:
Q |
203 |
aatgaaggatgatttggtggaccaaatatgcaaacagacacccttttatgacctatg |
259 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50632230 |
aatgaaggatgatttggtggaccaaatatgcaaacagacacccttttatgacctatg |
50632174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1580 times since January 2019
Visitors: 4422