View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0681_low_2 (Length: 529)
Name: NF0681_low_2
Description: NF0681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0681_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 47 - 89
Target Start/End: Complemental strand, 10933647 - 10933605
Alignment:
Q |
47 |
taaggatgaagagggattgggaatttcggaagctcacacattt |
89 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
10933647 |
taaggatgaagaaggattgggaatttcggaagctcacacattt |
10933605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 551 times since January 2019
Visitors: 4385