View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0681_low_28 (Length: 232)

Name: NF0681_low_28
Description: NF0681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0681_low_28
NF0681_low_28
[»] chr3 (2 HSPs)
chr3 (155-232)||(20385178-20385255)
chr3 (1-73)||(20385337-20385409)
[»] chr4 (1 HSPs)
chr4 (194-231)||(19312956-19312993)


Alignment Details
Target: chr3 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 155 - 232
Target Start/End: Complemental strand, 20385255 - 20385178
Alignment:
155 ataggactgggattagggtttgtttaaaagaaacaaagaaaactgtatgccttgacttggggaggaggaaagtgcgtc 232  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20385255 ataggattgggattagggtttgtttaaaagaaacaaagaaaactgtatgccttgacttggggaggaggaaagtgcgtc 20385178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 20385409 - 20385337
Alignment:
1 ataaaactgaaactgaagaagctagggaaaaattgcggtcgtcagtggctagggttttatgttttttggaata 73  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20385409 ataaaactgaaactgaaaaagctagggaaaaattgcggtcgtcagtggctagggttttatgttttttggaata 20385337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 194 - 231
Target Start/End: Original strand, 19312956 - 19312993
Alignment:
194 aaactgtatgccttgacttggggaggaggaaagtgcgt 231  Q
    ||||||||||||||| ||||||||||||||||| ||||    
19312956 aaactgtatgccttggcttggggaggaggaaagcgcgt 19312993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University