View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0681_low_28 (Length: 232)
Name: NF0681_low_28
Description: NF0681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0681_low_28 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 155 - 232
Target Start/End: Complemental strand, 20385255 - 20385178
Alignment:
| Q |
155 |
ataggactgggattagggtttgtttaaaagaaacaaagaaaactgtatgccttgacttggggaggaggaaagtgcgtc |
232 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20385255 |
ataggattgggattagggtttgtttaaaagaaacaaagaaaactgtatgccttgacttggggaggaggaaagtgcgtc |
20385178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 20385409 - 20385337
Alignment:
| Q |
1 |
ataaaactgaaactgaagaagctagggaaaaattgcggtcgtcagtggctagggttttatgttttttggaata |
73 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20385409 |
ataaaactgaaactgaaaaagctagggaaaaattgcggtcgtcagtggctagggttttatgttttttggaata |
20385337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 194 - 231
Target Start/End: Original strand, 19312956 - 19312993
Alignment:
| Q |
194 |
aaactgtatgccttgacttggggaggaggaaagtgcgt |
231 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
19312956 |
aaactgtatgccttggcttggggaggaggaaagcgcgt |
19312993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University