View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0681_low_5 (Length: 494)
Name: NF0681_low_5
Description: NF0681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0681_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 392; Significance: 0; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 83 - 474
Target Start/End: Original strand, 1430785 - 1431176
Alignment:
| Q |
83 |
agcaacgtctagttcctgaccgttttctgccataaccacgcttgccagaacataatgctctaaagcactttcataatcaccttttgagtcacagattagt |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1430785 |
agcaacgtctagttcctgaccgttttctgccataaccacgcttgccagaacataatgctctaaagcactttcataatcaccttttgagtcacagattagt |
1430884 |
T |
|
| Q |
183 |
cccatcaatctccgatcagctgcttcttcaaacgatgcaggcaaaccatttcccttatgaatatcaagagccatttgacacagcttcttcgcttcatcaa |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1430885 |
cccatcaatctccgatcagctgcttcttcaaacgatgcaggcaaaccatttcccttatgaatatcaagagccatttgacacagcttcttcgcttcatcaa |
1430984 |
T |
|
| Q |
283 |
attgtagggcttgaacatgtgcttcggctacataccgacatgtctcaccgaatcgaggatcggtttcccctaggacctgcccttgaatttcaagacctgc |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1430985 |
attgtagggcttgaacatgtgcttcggctacataccgacatgtctcaccgaatcgaggatcggtttcccctaggacctgcccttgaatttcaagacctgc |
1431084 |
T |
|
| Q |
383 |
tgtataaaacagtagagaattctcaatatttcccatcattgcataagtatcacctaattgcatacaccctgcaaacttagctagtgcatgat |
474 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1431085 |
tgtataaaacagtagagaattctcaatatttcccatcattgcataagtatcacctaattgcatacaccctgcaaacttagctagtgcatgat |
1431176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 400 - 474
Target Start/End: Complemental strand, 1250714 - 1250640
Alignment:
| Q |
400 |
aattctcaatatttcccatcattgcataagtatcacctaattgcatacaccctgcaaacttagctagtgcatgat |
474 |
Q |
| |
|
||||||| |||||||||||||||| |||||| ||| ||||| || |||| ||||||||||||| ||||||||| |
|
|
| T |
1250714 |
aattctcgatatttcccatcattgtataagtgtcatgtaatttcacgcaccatgcaaacttagcttgtgcatgat |
1250640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 291 - 376
Target Start/End: Complemental strand, 1250810 - 1250725
Alignment:
| Q |
291 |
gcttgaacatgtgcttcggctacataccgacatgtctcaccgaatcgaggatcggtttcccctaggacctgcccttgaatttcaag |
376 |
Q |
| |
|
|||||||||||||| || ||||| | | ||||||||||||||||| |||||| |||||||| | | |||| ||| |||||||||| |
|
|
| T |
1250810 |
gcttgaacatgtgcctcagctacgtgcatacatgtctcaccgaatctaggatcagtttcccccaagtcctgacctggaatttcaag |
1250725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 238 - 286
Target Start/End: Original strand, 43926838 - 43926886
Alignment:
| Q |
238 |
tatgaatatcaagagccatttgacacagcttcttcgcttcatcaaattg |
286 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||| || ||||||||||| |
|
|
| T |
43926838 |
tatgaatatcaagagcaatttgacacagcctctcagcctcatcaaattg |
43926886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1140 times since January 2019
Visitors: 4365