View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0681_low_7 (Length: 435)
Name: NF0681_low_7
Description: NF0681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0681_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-116
Query Start/End: Original strand, 20 - 263
Target Start/End: Complemental strand, 47852049 - 47851806
Alignment:
Q |
20 |
gacatcatcaacattctgcattttgttgctttctggtttctatctgaattacgaccaatctttctgatatatacataataaatatgaatagtctttcatt |
119 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47852049 |
gacatcataaacattctgcattttgttgctttctggtttctatctgaattacgaccaatctttctgatatatacataataaatatgaatagtctttcatt |
47851950 |
T |
 |
Q |
120 |
aagttattgttagttgannnnnnnnnaccgaaagaatttttaatgttgaagttttcagaaaaattaaagtcgtatcatacatcattttcatcttctgcgc |
219 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47851949 |
aagttattgttagttgatttttttttaccgaaagaatttttaatgttgaagttttcagaaaaattaaagtcgtatcatacatcattttcatcttctgcgc |
47851850 |
T |
 |
Q |
220 |
tatatttcttattgtatgagagattgtttatctttcaattttag |
263 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47851849 |
tatatttcttattgtatgagagattgtttatctttcaattttag |
47851806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University