View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0682_high_14 (Length: 296)
Name: NF0682_high_14
Description: NF0682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0682_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 14 - 276
Target Start/End: Complemental strand, 48801217 - 48800953
Alignment:
| Q |
14 |
agaattataattctgatatggtaaacaaagtatagcctattgcgccatccacatatatctagtagtttatacactccagatgtctagtctctggcttgag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48801217 |
agaattataattctgatatggtaaacaaagtatagcctattgagccatccacatatatctagtagtttatacactccagatgtctagtctctggcttgag |
48801118 |
T |
 |
| Q |
114 |
gaatgtgttgagagtccttcaagccggttttttgaatattttgagtccggtccaatttttaaaac--tagttcgcctatttctctttctaacttttgggt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
48801117 |
gaatgtgttgagagtccttcaagccggttttttgaatattttgagtccggtccaatttttaaaacattagttggcctatttctctttctaacttttgggt |
48801018 |
T |
 |
| Q |
212 |
attcaaaccaagtgtattagacaaaaatatctcatgctttatttgattgtctgcttcatctcact |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48801017 |
attcaaaccaagtgtattagacaaaaatatctcatgctttatttgattgtctgcttcttctcact |
48800953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University