View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0682_high_19 (Length: 251)

Name: NF0682_high_19
Description: NF0682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0682_high_19
NF0682_high_19
[»] chr1 (2 HSPs)
chr1 (1-129)||(37128294-37128422)
chr1 (161-243)||(37128407-37128489)


Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 37128294 - 37128422
Alignment:
1 gttttgggacgagaatttgttttgaatggattggttttggttattgagttgaatgcagagtagttaatgttcttatacattttgatgaaagtcaagcgaa 100  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
37128294 gttttgggactagaatttgttttgaatggattggttttggttattgagttgaatgcagagtagttaatgttcttttacattttgatgaaagtcaagtgaa 37128393  T
101 caattaatttgaggttagaattgcttact 129  Q
    |||||||||||||||||||||||||||||    
37128394 caattaatttgaggttagaattgcttact 37128422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 161 - 243
Target Start/End: Original strand, 37128407 - 37128489
Alignment:
161 gttagaatcactttctcttcatggaagtcaaacacccaaattcgtatcaaaatcgattttatgattcacatgaccttcatctc 243  Q
    ||||||||  ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
37128407 gttagaattgcttactcttcatggaagtcaaacacccaaattcgtatcaaaatcgattttatgattcacataaccttcatctc 37128489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 726 times since January 2019
Visitors: 4390