View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0682_high_3 (Length: 448)
Name: NF0682_high_3
Description: NF0682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0682_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 266 - 442
Target Start/End: Complemental strand, 5233185 - 5233005
Alignment:
Q |
266 |
attgttgatgaaatatcttaatttttt---gtcaaaaaa-tactttgcaatctctttctagatttaacaaaagtttaaaattatgaccccccaatgacca |
361 |
Q |
|
|
||||||||||||||| ||||||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5233185 |
attgttgatgaaatagcttaattttgtttggtcaaaaaaatactttgcaatctctttctagatttaacaaaagtttaaaattatgaccccccaatgacca |
5233086 |
T |
 |
Q |
362 |
tcttatatgtgcaatttctccatttacatatttgtgacacatgtaacacatagttttacataattgacatcttcatctcac |
442 |
Q |
|
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
5233085 |
tcttatatgtgcaatttctccatttagacatttgtgacacatgtaacacatagttttacataattgacatcttcatgtcac |
5233005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 155 - 237
Target Start/End: Complemental strand, 5233288 - 5233205
Alignment:
Q |
155 |
aggaaggaaacccatttatttgca-cgtaccttaataggggtggacacatatatggctaccattcaaaattgtaatgaaaatac |
237 |
Q |
|
|
|||||||||||||||||||||| | ||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
T |
5233288 |
aggaaggaaacccatttatttgaaacgtaccttagtaggggtggacacatatatggctaccattaaaaattgtagtgaaaatac |
5233205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1383 times since January 2019
Visitors: 4368