View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0682_low_20 (Length: 330)
Name: NF0682_low_20
Description: NF0682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0682_low_20 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 102 - 330
Target Start/End: Complemental strand, 48801760 - 48801532
Alignment:
| Q |
102 |
cacttcttatactatccttcaatcagaaatagacatgtctttttggtactgttgttgaaagacactttgtgaaacaggctggtggaccaagggttcagat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48801760 |
cacttcttatactatccttcaatcagaaatagacatgtctttttggtactgttgttgaaagacactttgtgaaacaggctggtggaccaagggttcagat |
48801661 |
T |
|
| Q |
202 |
tcctacaggtaggagagatggaatggtttcaattgcttcaaatgttagacccaacattgtggacactagttttactatggacgagatgcttaagctcttt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48801660 |
tcctacaggtaggagagatggaatggtttcaattgcttcaaatgttagacccaacattgtggacactagttttactatggacgagatgcttaagctcttt |
48801561 |
T |
|
| Q |
302 |
tccagtaaaggattgtccttacttgatct |
330 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48801560 |
tccagtaaaggattgtccttacttgatct |
48801532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 574 times since January 2019
Visitors: 4387