View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0682_low_28 (Length: 310)
Name: NF0682_low_28
Description: NF0682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0682_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 88 - 231
Target Start/End: Original strand, 4491137 - 4491280
Alignment:
| Q |
88 |
cagcagctgaaccgtgggctgccgatctagcagaaacagtagcagaaaaactacttttctgccagacgctgtcactgtcggataggtaaagaatacgtgc |
187 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4491137 |
cagcagctgaaccgtgggctgctgatctagcagaaacagtagcagaaaaactacttttctgccagacgctgtcgctgtcggataggtaaagaatacgtgc |
4491236 |
T |
|
| Q |
188 |
aagttgtcttccaatgcatcgacacaaatagcacaattggttgg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4491237 |
aagttgtcttccaatgcatcgacacaaatagcacaattggttgg |
4491280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 114 - 231
Target Start/End: Original strand, 4505173 - 4505288
Alignment:
| Q |
114 |
ctagcagaaacagtagcagaaaaactacttttctgccagacgctgtcactgtcggataggtaaagaatacgtgcaagttgtcttccaatgcatcgacaca |
213 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||| ||||||||| |||||| ||||| |||| || |||||||| ||||||| || | |
|
|
| T |
4505173 |
ctagcagaaacagtagcagaaaaaccgcttttctgccagacactgcgactgtcggacaggtaatgaatatgtgcgagctgtcttccgatgcatcatcata |
4505272 |
T |
|
| Q |
214 |
aatagcacaattggttgg |
231 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
4505273 |
aat--cacaattggttgg |
4505288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 542 times since January 2019
Visitors: 4385