View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0682_low_30 (Length: 303)
Name: NF0682_low_30
Description: NF0682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0682_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 30 - 292
Target Start/End: Complemental strand, 43924684 - 43924423
Alignment:
| Q |
30 |
catagagtataatgatcaacaagggtnnnnnnncgtggtagtactagatttagcgatggttcatatcttttgctttgataccatgcagaaatatgtggta |
129 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43924684 |
catagagtgtaatgatcaacaagggtaaaaaaacgtggtagtactaaatttagcgatggttcgtatcttttgctttgataccatgcagaaatatgtggta |
43924585 |
T |
|
| Q |
130 |
tttttcattgtattgaaactgatacaagtcaagtatatatagtatacaaggactcagtggcatatcccggaccttgaaccacggggtgcaaacattttcg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43924584 |
tttttcattgtattgaaactgatacaagtcaagtatatatagtatacaaggactcaatggcatatcccggaccttgaaccac-gggtgcaaacattttcg |
43924486 |
T |
|
| Q |
230 |
ttttataaaattttgattttttattctcatgaaaaattctggacatgtcaatgttttattcat |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||||| |
|
|
| T |
43924485 |
ttttataaaattttgattttttattctcataaaaaagtctagacatgtcaatgttttattcat |
43924423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 218 - 265
Target Start/End: Original strand, 30256207 - 30256254
Alignment:
| Q |
218 |
caaacattttcgttttataaaattttgattttttattctcatgaaaaa |
265 |
Q |
| |
|
|||||||||| || |||||||| ||||||||||||||||||| ||||| |
|
|
| T |
30256207 |
caaacatttttgtcttataaaagtttgattttttattctcataaaaaa |
30256254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1066 times since January 2019
Visitors: 4402