View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0682_low_36 (Length: 278)
Name: NF0682_low_36
Description: NF0682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0682_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 12 - 272
Target Start/End: Original strand, 53721097 - 53721356
Alignment:
Q |
12 |
atgagtggatcatcagtaaagaagtagtgggtagaaaataacaaagattgaacagcacacatgtttgctaataagggaacattttgctcacttttaagac |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53721097 |
atgagtggatcatcagtaaagaagtagtgggtagaaaataacaaagattgaacagcacacatgtttgctaataagggaacattttgctcacttttaagac |
53721196 |
T |
 |
Q |
112 |
aatggtgcatcaagggccttaaccaagggacccttcattactaccnnnnnnnnaactccaactccaagttgaaatgcccttcgaatttgtccaaggataa |
211 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53721197 |
aatggtgcatcaagggccttaaccaagggacccttcattactacc-tttttttaactccaactccaagttgaaatgcccttcgaatttgtccaaggataa |
53721295 |
T |
 |
Q |
212 |
tatctaccttctaccctactcatacggaggtgtctttgtcacaccattctcatgtcatcat |
272 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53721296 |
tatctaccttctaccctactcatacggaggtgtctttgtcacaccattctcatgtcatcat |
53721356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University