View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0682_low_37 (Length: 264)
Name: NF0682_low_37
Description: NF0682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0682_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 44 - 242
Target Start/End: Complemental strand, 30275411 - 30275214
Alignment:
| Q |
44 |
atttcaggtagcaagagttaactaactgttagtgttctttataacatataaaagaactttgattcttctaattccattccatcactaaccagtgaattaa |
143 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30275411 |
atttcaggtagcaagagt-aactaactgttagtgttctttataacatataaaagaactttgattcttctaattccattccatcactaaccagtgaattaa |
30275313 |
T |
|
| Q |
144 |
ttatgcagaggacaaggagaatgccacaaaaagacgtagggtggagcgagcacgaaagtatgtaataataataatagaaaaattatactcatctctgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30275312 |
ttatgcagaggacaaggagaatgccacaaaaagacgtagggtggagcgagcacgaaagtatgtaataataataatagaaaaattatactcatctctgct |
30275214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1272 times since January 2019
Visitors: 4365