View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0682_low_40 (Length: 251)
Name: NF0682_low_40
Description: NF0682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0682_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 37128294 - 37128422
Alignment:
Q |
1 |
gttttgggacgagaatttgttttgaatggattggttttggttattgagttgaatgcagagtagttaatgttcttatacattttgatgaaagtcaagcgaa |
100 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
T |
37128294 |
gttttgggactagaatttgttttgaatggattggttttggttattgagttgaatgcagagtagttaatgttcttttacattttgatgaaagtcaagtgaa |
37128393 |
T |
 |
Q |
101 |
caattaatttgaggttagaattgcttact |
129 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
37128394 |
caattaatttgaggttagaattgcttact |
37128422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 161 - 243
Target Start/End: Original strand, 37128407 - 37128489
Alignment:
Q |
161 |
gttagaatcactttctcttcatggaagtcaaacacccaaattcgtatcaaaatcgattttatgattcacatgaccttcatctc |
243 |
Q |
|
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
37128407 |
gttagaattgcttactcttcatggaagtcaaacacccaaattcgtatcaaaatcgattttatgattcacataaccttcatctc |
37128489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University