View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0682_low_44 (Length: 228)
Name: NF0682_low_44
Description: NF0682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0682_low_44 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 81; Significance: 3e-38; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 69 - 149
Target Start/End: Complemental strand, 24883447 - 24883367
Alignment:
| Q |
69 |
atcattgatcctcacctatcccatttatcttcgatatctgatgttgttctccaactatttcccacactcttcccccatatt |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24883447 |
atcattgatcctcacctatcccatttatcttcgatatctgatgttgttctccaactatttcccacactcttcccccatatt |
24883367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 82 - 136
Target Start/End: Original strand, 32601043 - 32601097
Alignment:
| Q |
82 |
acctatcccatttatcttcgatatctgatgttgttctccaactatttcccacact |
136 |
Q |
| |
|
|||||| ||| |||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
32601043 |
acctattccagttatcttcaatatctcctgttgttctccaactatttcccacact |
32601097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 82 - 136
Target Start/End: Original strand, 32590572 - 32590626
Alignment:
| Q |
82 |
acctatcccatttatcttcgatatctgatgttgttctccaactatttcccacact |
136 |
Q |
| |
|
|||||| ||| ||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
32590572 |
acctatgccaattatctttaatatctcctgttgttctccaactatttcccacact |
32590626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 77 - 136
Target Start/End: Original strand, 34594086 - 34594145
Alignment:
| Q |
77 |
tcctcacctatcccatttatcttcgatatctgatgttgttctccaactatttcccacact |
136 |
Q |
| |
|
|||| |||||| ||| |||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
34594086 |
tccttacctattccaattatcttcaatatcacctgttgttctccaactatttcccacact |
34594145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University