View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0682_low_7 (Length: 450)
Name: NF0682_low_7
Description: NF0682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0682_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 6e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 4 - 228
Target Start/End: Original strand, 33502830 - 33503058
Alignment:
Q |
4 |
aattttcttcactgcaatatacttctgcccaatacaaaggagatcctactttcattgatccaactgctgtagaaattagttggggggaggttgaagattc |
103 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33502830 |
aattttcttcactgcaatatacttctgcccaatacaaaggagatcctactttcatagatccaactgctgtagaaattagttggggggaggttgaagattc |
33502929 |
T |
 |
Q |
104 |
ttcacctataactc----tattcttttttatggagaagagaaatttgatgaatcggcatttttacctgactccactttactcttagaacatccaattgct |
199 |
Q |
|
|
|||| ||||||||| |||||||||| | ||| | || ||||||||||||| | ||||| ||| ||| ||||||||||||| |||||||||| |||| |
|
|
T |
33502930 |
ttcaactataactctttttattctttttaacggacaggaagaatttgatgaatcagtattttcacccgaccccactttactcttggaacatccaactgct |
33503029 |
T |
 |
Q |
200 |
gtaacagaaagagccatttccaactgcat |
228 |
Q |
|
|
|||||||||||||||||||||| |||||| |
|
|
T |
33503030 |
gtaacagaaagagccatttccatctgcat |
33503058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 228 - 398
Target Start/End: Original strand, 33503598 - 33503769
Alignment:
Q |
228 |
tttcactatgaagatcaaaacttaattactttattactatt-ttatccttcctttttcatactcatttcattacatgcaacatcactgttagagtataat |
326 |
Q |
|
|
|||||| |||||||||| |||||| | ||||||||||| | |||| | |||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
33503598 |
tttcacaatgaagatcacaacttattcgctttattactagtattattcatcctttgtcatactcatttcattacatgcaacgtcactgttagagtataat |
33503697 |
T |
 |
Q |
327 |
caatcccatcccaaataatgaaaaatgggatcctgcaggcggttaaaaattaaaagaaatgaaaagataacc |
398 |
Q |
|
|
|| |||||| |||| | |||| | ||||||||||| ||| |||||||||||||||||||| ||||||| |
|
|
T |
33503698 |
caccaccatccaaaatgacaaaaagtaagatcctgcaggtggtaaaaaattaaaagaaatgaaaggataacc |
33503769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1346 times since January 2019
Visitors: 4368